Nowa wersja platformy, zawierająca wyłącznie zasoby pełnotekstowe, jest już dostępna.
Przejdź na https://bibliotekanauki.pl
Preferencje help
Widoczny [Schowaj] Abstrakt
Liczba wyników

Znaleziono wyników: 16

Liczba wyników na stronie
first rewind previous Strona / 1 next fast forward last
Wyniki wyszukiwania
help Sortuj według:

help Ogranicz wyniki do:
first rewind previous Strona / 1 next fast forward last
EN
The interaction of the commonly used organophosphorus insecticide dichlorvos (2,2-dichlorovinyl dimethyl phosphate) with synthetic and mammalian DNA was investigated by spectroscopic techniques. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and synthetic two-stranded oligomer of sequence 5' - d(TTGGATCCGAATTCAAGCTT)-3' Melting curves and circular dichroism spectra were taken for the DNAs in the presence of the insecticide at a dichlorvos/DNA molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were much less pronounced than in the case of CT DNA. Dichlorvos did not evoke significant changes in the circular dichroism spectra of both DNAs. Obtained results indicate that dichlorvos perturbs the thermal stability of DNA, which is evidence that the insecticide has the ability to interact directly with DNA. Because dichlorvos is primarily neurotoxic, evidence of non-specific effect could be important for assessing the environmental risk connected with its use.
EN
In this work we investigated the lymphocyte nuclear proteins which participated in DNA-protein cross-links induced by three platinum compounds: cis-DDP, trans-DDP and carboplatin. Our studies indicated that many proteins were cross- linked to DNA in the intact cell. Trans-DDP was the most effective cross-linker. The cross-linking process depended on time of the cells incubation with aforementioned compounds. Carboplatin produced the DNA-protein cross-links more slowly and less effectively than cis-DDP. After incubation of the cells with cis-DDP, trans- DDP and carboplatin a similar protein pattern was obtained. In case of all compounds studied 34.5 kDa protein was abundantly represented.
EN
Proteins recognizing DNA damaged by the chemical carcinogen N- acetoxy-acetylaminofluorene (AAAF) were analyzed in nuclear extracts from rat tissues, using a 36 bp oligonucleotide as the substrate and an electrophoretic mobility shift assay. Two major proteins that form complexes with DNA damaged by AAAF were detected; one of them also bound DNA damaged by cis-diammine-dichloroplatinum. The complex specific for AAAF-damaged DNA contained protein loosely attached to nuclear components. It was extracted with 0.1 M NaCl. The amount of this protein was estimated at about 105 copies per liver cell nucleus, and its probable size was about 42 kDa as detected by the Southwestern blotting assay. Its affinity for DNA damaged by AAAF was ~10-fold higher than that for undamaged DNA. Analogous AAAF- DDB (damaged-DNA-binding) proteins were also detected in extracts from rat brain, testis and kidney tissue. The levels of such proteins were not affected in rats treated with the carcinogen 2-acetylaminofluorene.
first rewind previous Strona / 1 next fast forward last
JavaScript jest wyłączony w Twojej przeglądarce internetowej. Włącz go, a następnie odśwież stronę, aby móc w pełni z niej korzystać.